Name of sequence Accession Number 5' terminus 3' terminus Size Start Stop Strand
gi|58082243|gb|AC155381.2|AC155381 AC155381 ATCTCTACTAATTAT GCAACGCACGGGCACTCACCTAGT 106 67275 67381 +
gi|92110183|gb|AC185320.1|AC185320 AC185320 ATCTATACTACTCTA GCAAAGCACGGGCACTCACCTAGT 148 154746 154894 +
gi|58082331|gb|AC155470.2|AC155470 AC155470 ATCTGTATCTATA ACGCACGTGCACTCACCTAGT 300 91304 91004 -
gi|89257762|gb|AC182105.2|AC182105 AC182105 ATCCCTACTACTAAT GCAACGCACGGGCACCCACCTAGT 678 50022 49344 -
gi|89257762|gb|AC182105.2|AC182105 AC182105 ATCTATACTACTTAT GCAACGCACGGGCACCCACCTAGT 691 50035 49344 -
gi|90968587|gb|AC184176.1|AC184176 AC184176 ATCTCTACTACTTAT CAACGCACGGATACTCATCTAGT 996 142616 143612 +
gi|58082449|gb|AC155590.2|AC155590 AC155590 ATCTCTACTACTTAT GCAACTCACGGGCACTCACCTAGT 1348 184867 183519 -
gi|93204900|gb|AC185517.1|AC185517 AC185517 ATCTCTACTACTTAT GCAACGCACGGGCATTCAGCTAGT 1380 133226 131846 -
gi|88687856|gb|AC182823.1|AC182823 AC182823 ATCTCTACTACTTAT GCAACGTACGGGCACTCACCTAGT 1406 101808 103214 +
gi|58082341|gb|AC155481.2|AC155481 AC155481 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 1423 81699 80276 -
gi|57790154|gb|AC150780.2|AC150780 AC150780 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 1463 42287 43750 +
gi|89257716|gb|AC177834.2|AC177834 AC177834 ATCTCTACTACTTAT GCAACGCACGGGTACTCACCTAGT 1506 26957 28463 +
gi|90704951|gb|AC184048.1|AC184048 AC184048 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 1515 23561 25076 +
gi|58082368|gb|AC155508.2|AC155508 AC155508 ATCTCTACTACTTAT GCAACGCACGGGCATTCATCTAGT 1534 103666 102132 -
gi|55741054|gb|AY664415.1|AY664415 AY664415 ATCTCTACTACTC CGCACAGGCACTATACTAGT 1539 266035 267574 +
gi|25992759|gb|AF546186.1|AF546186 AF546186 ATCTCTACTACTTAT TGCAACGCACGAGTACTCATCTAGT 1543 8764 10307 +
gi|93352727|gb|AC185613.1|AC185613 AC185613 ATCTCTACTACTTAT AACGCACGGGTACTCACCTAGT 1545 51164 52709 +
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTATACTACTTAT AACGCACGGGTACTCACCTAGT 1565 91499 89934 -
gi|85861397|gb|AC177887.1|AC177887 AC177887 ATCTATACTACTTAT GCAACGCACGGGTACTCACCTAGT 1584 98246 99830 +
gi|89365857|gb|AC183591.1|AC183591 AC183591 ATCTCTACTACTTAT GCAACGCACGGGCATTCAGCTAGT 1584 89838 88254 -
gi|51556351|gb|AC148100.2|AC148100 AC148100 ATCTCTACTACTTAT GCAACGCACGGGTACTCACCTAGT 1590 106147 107737 +
gi|85861334|gb|AC177824.1|AC177824 AC177824 ATCTCTACTACTTAT GCAACGCACGGACACTCACCTAGT 1591 107127 105536 -
gi|33321038|gb|AF488416.1|AF488416 AF488416 ATCTCTACCATTTAT GCAACGCACGGACACTCACCTAGT 1592 83891 85483 +
gi|58082444|gb|AC155585.2|AC155585 AC155585 ATCTATACTACTTAT GCAACGCACGGGTACTCACCTAGT 1608 87363 85755 -
gi|58531563|gb|AC149308.3|AC149308 AC149308 ATCTCTACTACTTAT GCAACGCACGGACACTCACCTAGT 1615 45471 47086 +
gi|89257721|gb|AC177843.2|AC177843 AC177843 ATCTCTACTACTTAT GCAACGCACGGGCACTCAGCTAGT 1622 14257 12635 -
gi|88024660|gb|AC182625.1|AC182625 AC182625 ATCTCTACTACTTAT GCAACGCACGGGTACTCACCTAGT 1622 113008 114630 +
gi|90963037|gb|AC184165.1|AC184165 AC184165 ATCTCTACTACTTAT AACGCACGGGCGCTCAGCTAGT 1625 32855 34480 +
gi|93352727|gb|AC185613.1|AC185613 AC185613 ATCTCTACTACTTAT TGCAACGTACGAGCACTCACCTAGT 1638 89435 91073 +
gi|90992704|gb|AC184707.1|AC184707 AC184707 ATCTCTACTACTTA GCAACGCACCGGCACTCACCTAGT 1642 69297 67655 -
gi|58082401|gb|AC155542.2|AC155542 AC155542 ATCTCTACTACTTAT GCAACGCACGGGAATTCAGCTAGT 1647 96088 97735 +
gi|48762540|gb|AC145727.7|AC145727 AC145727 ATCTCTACTACTTAT GCAACGCATGGGTACTCACCTAGT 1648 27858 29506 +
gi|89257762|gb|AC182105.2|AC182105 AC182105 ATCTATACTACTTAT GCAACGCACGGGCACCCACCTAGT 1691 51035 49344 -
gi|58082445|gb|AC155586.2|AC155586 AC155586 ATCTATACTACTC GCAACGCACGGGCACTCTACTAGT 1694 184441 186135 +
gi|91176469|gb|AC184831.1|AC184831 AC184831 ATCTCTACTACTC GCAACGTACGGGCACTCACCTAGT 1736 77980 79716 +
gi|58082361|gb|AC155501.2|AC155501 AC155501 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 1802 115866 117668 +
gi|58082459|gb|AC155600.2|AC155600 AC155600 ATCTCTACTACTT GCAACGCACGGGCACTCACCTAGT 1845 21951 20106 -
gi|46451245|gb|AY555143.1|AY555143 AY555143 ATCTCTACTAATTAT GCAACGCACGGGTACTCACCTAGT 1845 140408 138563 -
gi|91932909|gb|AC185211.1|AC185211 AC185211 ATCTATACTACTCTA GCAACGCACGGGCACTCACCTAGT 1886 66102 67988 +
gi|89274357|gb|AC183513.1|AC183513 AC183513 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 2104 45264 43160 -
gi|55741096|gb|AY664419.1|AY664419 AY664419 ATCTCTTCTATTAAA CGATAGGGCGCTTTCCTATTCTAGT 2455 238233 240688 +
gi|57790150|gb|AC149828.2|AC149828 AC149828 ATCTCTACTACTTAT GCAACGCACGGGCATCCAGCTAGT 2599 90395 87796 -
gi|91932919|gb|AC185221.1|AC185221 AC185221 ATCTATACTACTTAT GCAACGCACGGGCATCCAGCTAGT 2613 84141 81528 -
gi|58082368|gb|AC155508.2|AC155508 AC155508 ATCTCTACTAATTAT AGCAACGCACGGACATACACCTAGT 2633 131507 134140 +
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCCCTACTACTAAT GCACGGGCACATACCTAGT 2680 7749 5069 -
gi|90963041|gb|AC184169.1|AC184169 AC184169 ATCCCTACTACTAAT GCACGGGCACATACCTAGT 2680 86146 88826 +
gi|92900493|gb|AC185454.1|AC185454 AC185454 ATCTCTACTACTTAT GCAACGCACGGGCATCCAGCTAGT 2682 15780 13098 -
gi|17082476|gb|AF391808.2|AF391808 AF391808 ATCTAAAGTATTAAA CCGTATGGGCGCCCCATGTTCTAGT 2713 140481 143194 +
gi|89257714|gb|AC177831.2|AC177831 AC177831 ATCTCTACTACTTAT ACGCACGAGCACTCACCTAGT 2940 190087 187147 -
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTCTACTACTC AGCAACGCACGGGCACTCACCTAGT 3038 82048 79010 -
gi|88900603|gb|AC183314.1|AC183314 AC183314 ATCTCTACTACTTAT GCAACGCACGGGCACCTACCTAGT 3061 9000 12061 +
gi|57790161|gb|AC149836.2|AC149836 AC149836 ATCTATACTACTCT AGCAACGCACGGGCATATTCCTAGT 3110 62146 65256 +
gi|92900965|gb|AC185478.1|AC185478 AC185478 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 3161 84053 87214 +
gi|89257794|gb|AC177923.2|AC177923 AC177923 ATCTAAAGTATTAAA CCGTATGGGCGCCCCATGTTCTAGT 3218 75081 78299 +
gi|93352726|gb|AC185612.1|AC185612 AC185612 ATCTCTACTACTTAT GGCAAAGCACGGACACGAACCTAGT 3375 66245 69620 +
gi|25992762|gb|AF546189.1|AF546189 AF546189 ATCTCTACTACTTAT GCAATGCACGGGCACATATCTAGT 3407 2446 5853 +
gi|46981888|gb|AY530951.1|AY530951 AY530951 ATCTCTACTACTC GCAACGCACGGACACTCAACTAGT 3434 134621 138055 +
gi|92900084|gb|AC185441.1|AC185441 AC185441 ATCTATACTACTT GCAACGCACGGGCATATACCTAGT 3443 21480 24923 +
gi|92900608|gb|AC185460.1|AC185460 AC185460 ATCCCTACTACTA AGCAACGCACGGGCATACACCTAGT 3448 62454 59006 -
gi|89274354|gb|AC182419.3|AC182419 AC182419 ATCTATACTACTC GCAACGCACGGGCATCCACCTAGT 3501 30831 34332 +
gi|85861385|gb|AC177875.1|AC177875 AC177875 ATCTATACTACTCTA GCAACGCACGGGCAATGAACTAGT 3634 122483 126117 +
gi|58082241|gb|AC155379.2|AC155379 AC155379 ATCTCTACTACTC GCAACGCACGGGCACCTACCTAGT 3784 44990 41206 -
gi|88900607|gb|AC182604.2|AC182604 AC182604 ATCTCTACTACTTAT ACGCACGAGCACTCACCTAGT 3834 13082 9248 -
gi|58082483|gb|AC155624.2|AC155624 AC155624 ATCTCTACTACTT CGCACGGGTACATACCTAGT 3893 65801 69694 +
gi|58082359|gb|AC155499.2|AC155499 AC155499 ATCTCTACTACTC AGCAACGCACGGGCATATACCTAGT 4004 41461 45465 +
gi|85861425|gb|AC177915.1|AC177915 AC177915 ATCTCTACTACTC GCAACGCACGGGTATTCACCTAGT 4068 43827 39759 -
gi|94442568|gb|AC186020.1|AC186020 AC186020 ATCTATACTACTCTA GCAACGCACGGGCACTTACCTAGT 4318 70532 66214 -
gi|92900608|gb|AC185460.1|AC185460 AC185460 ATCTATACTACTTA AGCAACGCACGGGCATACACCTAGT 4348 63354 59006 -
gi|88687863|gb|AC182830.1|AC182830 AC182830 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 4368 104101 99733 -
gi|90568140|gb|AC183928.1|AC183928 AC183928 ATCTATACTACTTAT TGCAACGCACGGGCACTGACCTAGT 4489 89608 94097 +
gi|94481352|gb|AC186149.1|AC186149 AC186149 ATCTCTACTACTC TGCAACACACGGACACTCACCTAGT 4773 143661 138888 -
gi|58082316|gb|AC155455.2|AC155455 AC155455 ATCTCTACTACTTAT TGCAACGCACGAGCACTGACCTAGT 4825 107003 102178 -
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTCTACTACTCCT GCAACGCACGGGCACTCACCTAGT 4949 210886 205937 -
gi|85861326|gb|AC177816.1|AC177816 AC177816 ATCTATACTACTTAT GCAACGCACGGGCACACAACTAGT 4951 93769 98720 +
gi|89337323|gb|AC183518.1|AC183518 AC183518 ATCTCTACTACTTAT TGCAACGCACGGGCACTGTCCTAGT 4998 53355 48357 -
gi|85861434|gb|AC177924.1|AC177924 AC177924 ATCTCTACTACTT GCAACGCACGGGTACTCACCTAGT 5019 153618 158637 +
gi|67043716|gb|DQ002406.1|DQ002406 DQ002406 ATCTCTACTACTCCT TGCAACGCACGAGCACTCGCCTAGT 5053 61261 66314 +
gi|58082269|gb|AC155407.2|AC155407 AC155407 ATCTCTACTACTC TGCAACGTACGGGCACTCAACTAGT 5065 7000 12065 +
gi|92901217|gb|AC185486.1|AC185486 AC185486 ATCTATACTACTT GCAACGCACGGGCACATACCTAGT 5165 95507 90342 -
gi|23928433|gb|AF528565.1|AF528565 AF528565 ATCTATACTACTCTA GGCATCGCACGGGCACATACCTAGT 5234 16018 21252 +
gi|90568139|gb|AC183927.1|AC183927 AC183927 ATCTCTACTACTC GCAACGCACGGACACTCACCTAGT 5431 73223 78654 +
gi|91932911|gb|AC185213.1|AC185213 AC185213 ATCTCTACTACTCCT AGCAACGCACGAGCATTCACCTAGT 5440 17822 12382 -
gi|89337323|gb|AC183518.1|AC183518 AC183518 ATCTCTACTACTTAT TGCAACGCACGGGCACTGTCCTAGT 5443 53800 48357 -
gi|91932918|gb|AC185220.1|AC185220 AC185220 ATCTCTACTACTC GCAAGGCACGGGCACATACCTAGT 5558 109205 103647 -
gi|89257778|gb|AC177894.2|AC177894 AC177894 ATCTCTACTACTTAT GCAACGCACGGGCACTCAGCTAGT 5666 110905 116571 +
gi|51315588|gb|AC148166.3|AC148166 AC148166 ATCTATACTACTTAT AACGCACGAGCACTTACCTAGT 5748 52064 57812 +
gi|90992704|gb|AC184707.1|AC184707 AC184707 ATCTCTACTACTT AGCAACGCACGGACACACACCTAGT 5750 104592 110342 +
gi|17082476|gb|AF391808.2|AF391808 AF391808 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 5859 139590 133731 -
gi|58082433|gb|AC155574.2|AC155574 AC155574 ATCTCTACTACTC AGCAACGCACGGGCACATACCTAGT 5860 125921 131781 +
gi|89257724|gb|AC177849.2|AC177849 AC177849 ATCCCTACTACTAAT GGCATCGCACGGGCACCTACCTAGT 5868 108946 114814 +
gi|58531566|gb|AC149476.3|AC149476 AC149476 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 5874 49531 43657 -
gi|89257775|gb|AC177893.2|AC177893 AC177893 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 5950 84209 78259 -
gi|62238005|gb|AC159612.1|AC159612 AC159612 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 6001 11715 5714 -
gi|58082321|gb|AC155460.2|AC155460 AC155460 ATCTCTACTACTC GGCATCGCACGGGCACCTACCTAGT 6121 12076 5955 -
gi|58082428|gb|AC155569.2|AC155569 AC155569 ATCTCTACTACTC GGCATCGCACGGGCACCTACCTAGT 6121 126551 120430 -
gi|25992762|gb|AF546189.1|AF546189 AF546189 ATCTATACTACCTAT GGCATCGCACGGGCACCTACCTAGT 6153 44051 50204 +
gi|42491468|gb|AC148169.2|AC148169 AC148169 ATCTCTACTACTTAT GGCAACGCACGGGCACGAACCTAGT 6189 113489 119678 +
gi|13606087|gb|AF090447.2|AF090447 AF090447 ATCTCTACTACTCCT GCAACGCACGGGCACATACCTAGT 6293 4408 10701 +
gi|46981892|gb|AY530952.1|AY530952 AY530952 ATCTCTACTACTTAT GGCATCGCACGGGCACCTACCTAGT 6297 28681 34978 +
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTGTATCTATATC GCAACGCACGGGTACATACCTAGT 6311 180459 186770 +
gi|90992704|gb|AC184707.1|AC184707 AC184707 ATCTATACTACTTAT GCAACGCACCGGCACTCACCTAGT 6329 73984 67655 -
gi|89941530|gb|AC183785.1|AC183785 AC183785 ATCTATACTACTCTA GGCATCGCACGGGCACCTACCTAGT 6400 142831 136431 -
gi|58082484|gb|AC155625.2|AC155625 AC155625 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 6416 21841 15425 -
gi|89257713|gb|AC177829.2|AC177829 AC177829 ATCTCTACTACTC GGCAACCCACGGGCACATACCTAGT 6525 73865 67340 -
gi|57790159|gb|AC149832.2|AC149832 AC149832 ATCTCTACTACTCCT GCAACGCACGGGCACCTACCTAGT 6625 77461 84086 +
gi|58082401|gb|AC155542.2|AC155542 AC155542 ATCTCTACTACTTAT GCAACGCACGGGTATTCACCTAGT 6703 96088 102791 +
gi|71725484|gb|AC166636.1|AC166636 AC166636 ATCTATACTACTT GCAACGCACGGGCACTCACCTAGT 6754 71209 64455 -
gi|34559165|gb|AY371488.1|AY371488 AY371488 ATCTCTACTACTC TGCAACGCACGAGCACTCACCTAGT 6796 96530 89734 -
gi|85861384|gb|AC177874.1|AC177874 AC177874 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 6870 101286 94416 -
gi|58082307|gb|AC155446.2|AC155446 AC155446 ATCTCTACTACTCCT GCAACGCACGGGCACCTACCTAGT 6945 97694 90749 -
gi|85861397|gb|AC177887.1|AC177887 AC177887 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 7178 24351 17173 -
gi|58082487|gb|AC155628.2|AC155628 AC155628 ATCTCTACTACTC GCAACGCACGGGCATGGACCTAGT 7323 121154 113831 -
gi|58082374|gb|AC155514.2|AC155514 AC155514 ATCTCTACTACTC GCAACGCACGGGCATGGACCTAGT 7387 89067 96454 +
gi|58082397|gb|AC155538.2|AC155538 AC155538 ATCTCTACTACTTAT CGCATCGCACGGGCACTCACCTAGT 7607 128031 135638 +
gi|90659932|gb|AC183969.1|AC183969 AC183969 ATCTCTACTACTC TGCAACGCACGAGCACCCACCTAGT 7613 40893 33280 -
gi|51315587|gb|AC148164.3|AC148164 AC148164 ATCTATACTACCTAT GCAACGCACGGACACTCTCCTAGT 7676 28837 21161 -
gi|58531556|gb|AC149270.3|AC149270 AC149270 ATCTAAAGTATTAAA GGGCGCCTCATGTTCTAGT 7716 144733 152449 +
gi|48762560|gb|AC148179.4|AC148179 AC148179 ATCTCTACTACTCC GCAACGCACGGGCAACTACCTAGT 7803 133646 141449 +
gi|88687866|gb|AC182833.1|AC182833 AC182833 ATCTCTACTACTCC GCAACGCACGGGCACCTACCTAGT 7805 112471 104666 -
gi|58531565|gb|AC149475.2|AC149475 AC149475 ATCTATACTACTC GCAACGCACGGGCACTCACCTAGT 7941 91885 99826 +
gi|58082483|gb|AC155624.2|AC155624 AC155624 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 7982 48622 56604 +
gi|58082488|gb|AC155629.2|AC155629 AC155629 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 7982 19731 11749 -
gi|58082322|gb|AC155461.2|AC155461 AC155461 ATCTCTACTACTTAT GCAACGCACGGGCACTCTCCTAGT 8019 27823 35842 +
gi|90963036|gb|AC184164.1|AC184164 AC184164 ATCTATACTACTTAT GCAACGCACGGGCACACACCTAGT 8089 34076 25987 -
gi|58082417|gb|AC155558.2|AC155558 AC155558 ATCTATACTACCTAT GCAACGCACGGGCACTCACCTAGT 8355 1211 9566 +
gi|89274329|gb|AC182413.3|AC182413 AC182413 ATCTATACTACTTA GCAACGCACGGGCATCCACCTAGT 8615 43592 52207 +
gi|57790161|gb|AC149836.2|AC149836 AC149836 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 8725 69846 78571 +
gi|91176469|gb|AC184831.1|AC184831 AC184831 ATCTCTACTACTC TTTCCTATTCTAGT 8771 77980 86751 +
gi|57790143|gb|AC149822.2|AC149822 AC149822 ATCTATACTACTTAT AGCAACGCACGGGCATATACCTAGT 8891 66889 75780 +
gi|58082324|gb|AC155463.2|AC155463 AC155463 ATCTCTACTACTCCT GCAACGCACGGGCATTCACCTAGT 9067 65949 56882 -
gi|67043717|gb|DQ002407.1|DQ002407 DQ002407 ATCTATACTACCTAT GCAACGCACGGGCACTCACCTAGT 9149 94515 103664 +
gi|67043718|gb|DQ002408.1|DQ002408 DQ002408 ATCTATACTACCTAT GCAACGCACGGGCACTCACCTAGT 9154 47751 56905 +
gi|58082233|gb|AC155370.2|AC155370 AC155370 ATCTATACTACTCTA TGCAACGCACGGGCACTGACCTAGT 9158 188911 198069 +
gi|90992704|gb|AC184707.1|AC184707 AC184707 ATCTCTACTACTTAT GCAACGCACCGGCACTCACCTAGT 9164 76819 67655 -
gi|25992762|gb|AF546189.1|AF546189 AF546189 ATCTATACTACCTAT GGCATCGCACGGGCACCTACCTAGT 9409 40795 50204 +
gi|93352746|gb|AC185632.1|AC185632 AC185632 ATCTATACTACTTAT TGCAACGCACGGGCACTTACCTAGT 9426 140228 149654 +
gi|58082484|gb|AC155625.2|AC155625 AC155625 ATCTCTACTACTTAT GCAACGCACGGGCATCCAGCTAGT 9503 21841 12338 -
gi|85861357|gb|AC177847.1|AC177847 AC177847 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 9542 129552 139094 +
gi|48717676|gb|AC148152.3|AC148152 AC148152 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 9797 17237 27034 +
gi|90568150|gb|AC183938.1|AC183938 AC183938 ATCTCTACTACTC GCAACGCACGGGCATTCTCCTAGT 10021 84523 74502 -
gi|58082350|gb|AC155490.2|AC155490 AC155490 ATCTATACTACCTAT TGCAACGCACGGGCACTGACCTAGT 10238 92177 102415 +
gi|58082458|gb|AC155599.2|AC155599 AC155599 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 10707 10451 21158 +
gi|58082458|gb|AC155599.2|AC155599 AC155599 ATCTCTACTACTTAT ACGCACGAGCACTCACCTAGT 10888 10451 21339 +
gi|55741096|gb|AY664419.1|AY664419 AY664419 ATCTCTACTACTC CGCAACGCACAGGCACTATACTAGT 10959 262091 273050 +
gi|46200524|gb|AF466202.2|AF466202 AF466202 ATCTCTACTAATT GCAACGCACGGGCACCTAACTAGT 11083 108047 96964 -
gi|88687856|gb|AC182823.1|AC182823 AC182823 ATCTCTACTACTTAT GCAACGTACGGGCACTCACCTAGT 11310 91904 103214 +
gi|58082403|gb|AC155544.2|AC155544 AC155544 ATCTATACTACTT TGCAACGCACGGGCACTGACCTAGT 11526 145923 134397 -
gi|91982810|gb|AC185266.1|AC185266 AC185266 ATCTCTACTACTTAT GCAACGCACAGACACTCACCTAGT 11541 33285 21744 -
gi|58082487|gb|AC155628.2|AC155628 AC155628 ATCTATACTACCTAT GCAACGCACGGGCACTCACCTAGT 11588 97157 108745 +
gi|58082329|gb|AC155468.2|AC155468 AC155468 ATCTATACTACTTAT GCAACGCACGGGCACTCTCCTAGT 11594 14079 2485 -
gi|58082374|gb|AC155514.2|AC155514 AC155514 ATCTATACTACCTAT GCAACGCACGGGCACTCACCTAGT 11617 113293 101676 -
gi|85861351|gb|AC177841.1|AC177841 AC177841 ATCTATACTACTTAT TGCAACGCACGGGCACTGACCTAGT 12098 64074 76172 +
gi|92087080|gb|AC165172.2|AC165172 AC165172 ATCTCTACTACTC GCAACACACGGGCACATACCTAGT 12364 101077 88713 -
gi|85861343|gb|AC177833.1|AC177833 AC177833 ATCTCTACTACTCCT GCAACGCACGGGCACATACCTAGT 12495 59291 46796 -
gi|93204899|gb|AC185516.1|AC185516 AC185516 ATCTATACTACCTAT GCAACACACGGGCACATACCTAGT 12641 75002 87643 +
gi|89257763|gb|AC182106.2|AC182106 AC182106 ATCTCTACTACTTAT TGCAACGTACGAGCACTCACCTAGT 12863 46944 34081 -
gi|89257775|gb|AC177893.2|AC177893 AC177893 ATCTATACTACCTAT GCAACGCACGGGCACTCTCCTAGT 12872 178518 165646 -
gi|58082421|gb|AC155562.2|AC155562 AC155562 ATCTATACTACTCTA GCAACGCACGGACACTCACCTAGT 12960 88443 75483 -
gi|89257709|gb|AC177820.2|AC177820 AC177820 ATCTCTACTACTTAT GCAACGCACGGGCACTCAGCTAGT 12977 185457 172480 -
gi|94481350|gb|AC186147.1|AC186147 AC186147 ATCTATACTACCTAT GCAACGCACGGGCATATACCTAGT 13237 173256 160019 -
gi|90568140|gb|AC183928.1|AC183928 AC183928 ATCTATACTACTTAT TGCAACGCACGGGCACTGACCTAGT 13360 80737 94097 +
gi|92899955|gb|AC185435.1|AC185435 AC185435 ATCTCTACTACTC GCAACGCACGGGTACTCACCTAGT 13474 115182 101708 -
gi|94403204|gb|AC185966.1|AC185966 AC185966 ATCTCTACTACTTAT GCAACGCACGGGCATTCGACTAGT 13617 105082 91465 -
gi|57790142|gb|AC149821.2|AC149821 AC149821 ATCTATACTACCTAT GCAACGCACGGGCATGTACCTAGT 13640 74238 87878 +
gi|46200524|gb|AF466202.2|AF466202 AF466202 ATCTCTACTAATT GCAACGCACGGACACATATCTAGT 13941 108047 94106 -
gi|58082490|gb|AC155631.2|AC155631 AC155631 ATCTCTACTACTC GCAACGCACGGGCACACAACTAGT 13971 250725 236754 -
gi|58082256|gb|AC155394.2|AC155394 AC155394 ATCTCTACTACTTAT GCAACACACGGGCACTCACCTAGT 14302 34732 49034 +
gi|89257790|gb|AC182481.2|AC182481 AC182481 ATCTCTACTACTC GCAACGCACGGGCATGTACCTAGT 14705 145876 160581 +
gi|58531565|gb|AC149475.2|AC149475 AC149475 ATCTATACTACTT GCAATGCACGGGCACACACCTAGT 15193 31316 46509 +
gi|13606087|gb|AF090447.2|AF090447 AF090447 ATCTCTACTACTCCT GCAACGCACGGGCATTCACCTAGT 15399 4408 19807 +
gi|85861384|gb|AC177874.1|AC177874 AC177874 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 15882 110298 94416 -
gi|57790161|gb|AC149836.2|AC149836 AC149836 ATCTATACTACTCT GCAACGCACGGGCACTCACCTAGT 16425 62146 78571 +
gi|90704951|gb|AC184048.1|AC184048 AC184048 ATCTCTACTACTCCT TGCAACACACAGACACTCACCTAGT 16670 20764 4094 -
gi|58531565|gb|AC149475.2|AC149475 AC149475 ATCTCTACTACTT GCAATGCACGGGCACACACCTAGT 16676 29833 46509 +
gi|92899987|gb|AC185437.1|AC185437 AC185437 ATCTCTACTACTTAT GCAACGCACGGGCATCCAGCTAGT 16805 156789 139984 -
gi|58082347|gb|AC155487.2|AC155487 AC155487 ATCTCTACTACTTAT GCAACGCACGGGCATCCACCTAGT 17221 116320 99099 -
gi|62751201|gb|AC160211.1|AC160211 AC160211 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 17654 90910 73256 -
gi|13606087|gb|AF090447.2|AF090447 AF090447 ATCTCTACTACTCCT GCAACGCACGGGCACATACCTAGT 17750 4408 22158 +
gi|58082373|gb|AC155513.2|AC155513 AC155513 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 17823 123734 141557 +
gi|89257714|gb|AC177831.2|AC177831 AC177831 ATCTCTACTACTTAT TGCAACGCACGGGCACTGACCTAGT 18140 169171 187311 +
gi|58082333|gb|AC155472.2|AC155472 AC155472 ATCCCTACTACTA AGCAAAGCACGGGCATACACCTAGT 18349 208202 226551 +
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTATACTACTTAT GCAATGCACGGGTACTCACCTAGT 18379 91499 73120 -
gi|90704951|gb|AC184048.1|AC184048 AC184048 ATCTCTACTACTCCT TGCAACACACAGACACTCACCTAGT 18464 22558 4094 -
gi|91932929|gb|AC185231.1|AC185231 AC185231 ATCTCTACTACTTAT GCAACGCACGGGCATCTACCTAGT 18561 112417 93856 -
gi|91932929|gb|AC185231.1|AC185231 AC185231 ATCTCTACTACTTAT GCAACGCACGGGCATCTACCTAGT 18870 112726 93856 -
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTATACTACCTAT CGCAACGCACGTGCACTCACCTAGT 19208 240548 259756 +
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTGTATCTATATC AGCAACGCACGGGCATTCAACTAGT 19328 180459 199787 +
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTATACTACTTAT AGCAACGCACGGGCACTCACCTAGT 19785 98795 79010 -
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTCTACTACTTAT GCAATGCACGGGCACTCTCCTAGT 20118 27588 47706 +
gi|58082315|gb|AC155454.2|AC155454 AC155454 ATCTATACTACCTA AGCAACGCACGGGCATGCACCTAGT 20533 122032 101499 -
gi|58082336|gb|AC155475.2|AC155475 AC155475 ATCTATACTACCTA AGCAACGCACGGGCATGCACCTAGT 20641 46033 25392 -
gi|93352759|gb|AC185645.1|AC185645 AC185645 ATCTATACTACCTAT GCAACGGACGGGCACTCACCTAGT 20695 33101 12406 -
gi|58082492|gb|AC155633.2|AC155633 AC155633 ATCCCTACTACTA AGCAAAGCACGGGCATACACCTAGT 20788 98183 77395 -
gi|48717635|gb|AC148101.3|AC148101 AC148101 ATCTATACTACTCTA GCAACGCACAGGCACTCACCTAGT 20852 46760 25908 -
gi|58082483|gb|AC155624.2|AC155624 AC155624 ATCTCTACTACTTAT CGCACGGGTACATACCTAGT 21072 48622 69694 +
gi|69747389|gb|AC165172.1|AC165172 AC165172 ATCTCTACTACTC GCAACACACGGGCACATACCTAGT 21262 115388 94126 -
gi|91065002|gb|AC184778.1|AC184778 AC184778 ATCTCTACTACTTAT GCAACGCACGGGTACTCACCTAGT 22330 136597 158927 +
gi|57790136|gb|AC149815.2|AC149815 AC149815 ATCTCTTCTATTA GCAACGCACGAGCACACACCTAGT 22771 114552 91781 -
gi|58082333|gb|AC155472.2|AC155472 AC155472 ATCTAAAGTATTAAA AACGCACGAGCACTCACCTAGT 22978 4622 27600 +
gi|92901217|gb|AC185486.1|AC185486 AC185486 ATCTATACTACTT GCAACGCACGGGCATCCACCTAGT 23690 95507 71817 -
gi|92110175|gb|AC185312.1|AC185312 AC185312 ATCTCTACTACTC GCAACGCACGGTCACTCACCTAGT 23864 139084 115220 -
gi|92899602|gb|AC185412.1|AC185412 AC185412 ATCTCTACTACTC AGCAACGCACGGGCATATACCTAGT 24218 176482 152264 -
gi|51556353|gb|AC148109.2|AC148109 AC148109 ATCTCTACTACTTAT GCAACGCACGGGTACTCACCTAGT 24649 63704 39055 -
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCCCTACTACTAA CAACGCATGGGCACTATACTAGT 25311 50510 75821 +
gi|92901217|gb|AC185486.1|AC185486 AC185486 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 25609 136455 110846 -
gi|46451245|gb|AY555143.1|AY555143 AY555143 ATCTCTACTAATTAT GGCACTCACCTAGT 30181 140408 110227 -
gi|58082459|gb|AC155600.2|AC155600 AC155600 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 30378 50484 20106 -
gi|58082351|gb|AC155491.2|AC155491 AC155491 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 34083 119114 85031 -
gi|19908841|gb|AF466931.1|AF466931 AF466931 ATCTCTACTACTTAT TGCAACGCACGAGCACTGACCTAGT 34580 48370 82950 +
gi|55667663|gb|AC152495.1|AC152495 AC152495 ATCTCTACTACTTAT TGCAACGCACGAGCACTGACCTAGT 34582 62119 27537 -
gi|89274360|gb|AC183516.1|AC183516 AC183516 ATCTCTACTACTC GCAACGCACGGGCACGTACCTAGT 34596 55167 20571 -
gi|55741096|gb|AY664419.1|AY664419 AY664419 ATCTCTTCTATTAAA CGCAACGCACAGGCACTATACTAGT 34817 238233 273050 +
gi|57790136|gb|AC149815.2|AC149815 AC149815 ATCTCTACTACTTAT TGCAACGCACGGGCACTTACCTAGT 34911 88261 123172 +
gi|19908846|gb|AF466932.1|AF466932 AF466932 ATCTCTACTACTTAT TGCAACGCACGAGCACTGACCTAGT 35066 38714 73780 +
gi|93352700|gb|AC185586.1|AC185586 AC185586 ATCTCTACTACTTAT TGCAACGCACGGGCACTGACCTAGT 35553 54441 18888 -
gi|92900608|gb|AC185460.1|AC185460 AC185460 ATCTCTACTACTTAT GGCAACGCACGGGCACGAACCTAGT 36685 15356 52041 +
gi|89274360|gb|AC183516.1|AC183516 AC183516 ATCTCTACTACTCCT GCAACGCACGGGCACGTACCTAGT 37281 57852 20571 -
gi|48762540|gb|AC145727.7|AC145727 AC145727 ATCTCTACTACTTAT GCAATGCACGGGCACTCACCTAGT 37350 102078 64728 -
gi|90963037|gb|AC184165.1|AC184165 AC184165 ATCTCTACTACTTAT AGCAACGCACGGGCATATACCTAGT 39293 32855 72148 +
gi|58082397|gb|AC155538.2|AC155538 AC155538 ATCTCTACTACTTAT GCAACGCACGGGCACACACCTAGT 39785 128031 167816 +
gi|93352727|gb|AC185613.1|AC185613 AC185613 ATCTCTACTACTTAT TGCAACGTACGAGCACTCACCTAGT 39909 51164 91073 +
gi|57790153|gb|AC149829.2|AC149829 AC149829 ATCTCTACCATTT AGCAATGCACGGGCATACACCTAGT 40704 120916 80212 -
gi|58082436|gb|AC155577.2|AC155577 AC155577 ATCTATACTACCTAT GGCATCGCACGGGCACCTACCTAGT 40969 52437 11468 -
gi|58082428|gb|AC155569.2|AC155569 AC155569 ATCTATACTACTCTA GGCATCGCACGGGCACCTACCTAGT 41133 161563 120430 -
gi|51315590|gb|AC148103.3|AC148103 AC148103 ATCTATACTACTTAT TGCAACACACGAACACTCACCTAGT 44261 36047 80308 +
gi|23928433|gb|AF528565.1|AF528565 AF528565 ATCTATACTACTCTA TGCAACGCACGGGCACTGACCTAGT 45553 16018 61571 +
gi|89257714|gb|AC177831.2|AC177831 AC177831 ATCTCTACTACTTAT GCAACGCACGGGCATTCACCTAGT 45736 190087 144351 -
gi|92901217|gb|AC185486.1|AC185486 AC185486 ATCTCTACTACTC GCAACGCACGGGCACATACCTAGT 46113 136455 90342 -
gi|25992762|gb|AF546189.1|AF546189 AF546189 ATCTCTACTACTTAT GGCATCGCACGGGCACCTACCTAGT 47758 2446 50204 +
gi|92899626|gb|AC185415.1|AC185415 AC185415 ATCTCTACTACTTAT CAACGCACGGGCATATACCTAGT 48228 61892 110120 +
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTCTACTACTTAT CAACGCATGGGCACTATACTAGT 48233 27588 75821 +
gi|92087123|gb|AC185291.1|AC185291 AC185291 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 48415 133538 85123 -
gi|58082237|gb|AC155374.2|AC155374 AC155374 ATCTCTACTACTTAT GCAACACACGGGCACTCACCTAGT 49591 11880 61471 +
gi|58082321|gb|AC155460.2|AC155460 AC155460 ATCTATACTACTCTA GGCATCGCACGGGCACCTACCTAGT 50811 56766 5955 -
gi|92110159|gb|AC183508.2|AC183508 AC183508 ATCTATACTACTC GCAACGCACGGGCATATACCTAGT 51289 150644 99355 -
gi|46981888|gb|AY530951.1|AY530951 AY530951 ATCTGTATCTATAT GCAACGCACGGACACTCAACTAGT 51367 86688 138055 +
gi|92110159|gb|AC183508.2|AC183508 AC183508 ATCTATACTACTC GCAACGCACGGGCACATCCCTAGT 51625 150644 99019 -
gi|58082262|gb|AC155400.2|AC155400 AC155400 ATCTCTACTACTTAT TGCAACACACGGACACTCAGCTAGT 53303 147799 94496 -
gi|90992691|gb|AC184694.1|AC184694 AC184694 ATCTCTTCTATTA GCAACGCACGGGCACCTACCTAGT 54466 2293 56759 +
gi|92900084|gb|AC185441.1|AC185441 AC185441 ATCTATACTACTT GGCAACGCACGAGTACATACCTAGT 54982 21480 76462 +
gi|89515022|gb|AC183659.1|AC183659 AC183659 ATCTATACTACTCTA GCAACGCACGGGCACATACCTAGT 56001 147622 91621 -
gi|90568150|gb|AC183938.1|AC183938 AC183938 ATCTCTACTAATT GCAACGCACGGGCATTCTCCTAGT 56308 130810 74502 -
gi|58082298|gb|AC155436.2|AC155436 AC155436 ATCTATACTACCTAT GCAACGCACGGGCACTCTCCTAGT 56353 103779 47426 -
gi|89257758|gb|AC182107.2|AC182107 AC182107 ATCTATACTACCTAT GCAACGCACGGGCATCTAACTAGT 56734 57466 114200 +
gi|58082239|gb|AC155376.2|AC155376 AC155376 ATCTGTATCTATA GCAACGTACGGACACTCACCTAGT 57102 29828 86930 +
gi|89257775|gb|AC177893.2|AC177893 AC177893 ATCTATACTACCTAT GGCATCGCACGGGCACCTACCTAGT 58663 178518 119855 -
gi|92087080|gb|AC165172.2|AC165172 AC165172 ATCTCTACTACTC GGCAACGCACGGTCACACACCTAGT 60404 101077 40673 -
gi|93352726|gb|AC185612.1|AC185612 AC185612 ATCTCTACTACTT GGCAAAGCACGGACACGAACCTAGT 63516 6104 69620 +
gi|93352726|gb|AC185612.1|AC185612 AC185612 ATCTCTACTACTTAT GGCAAAGCACGGACACGAACCTAGT 63529 6091 69620 +
gi|92901217|gb|AC185486.1|AC185486 AC185486 ATCTCTACTACTC GCAACGCACGGGCATCCACCTAGT 64638 136455 71817 -
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 66313 91499 25186 -
gi|89257721|gb|AC177843.2|AC177843 AC177843 ATCCCTACTACTA GCAACGCACGGGCACTCAGCTAGT 66728 79363 12635 -
gi|58531565|gb|AC149475.2|AC149475 AC149475 ATCTATACTACTT GCAACGCACGGGCACTCACCTAGT 68510 31316 99826 +
gi|93204902|gb|AC185519.1|AC185519 AC185519 ATCTATACTACTTAT GCAACGCACGGGCACTCACCTAGT 68851 53295 122146 +
gi|58531565|gb|AC149475.2|AC149475 AC149475 ATCTCTACTACTT GCAACGCACGGGCACTCACCTAGT 69993 29833 99826 +
gi|57790136|gb|AC149815.2|AC149815 AC149815 ATCTCTACTACTC TAGGGCGCTGCCCTATTCTAGT 71291 16368 87659 +
gi|57790150|gb|AC149828.2|AC149828 AC149828 ATCTCTACTACTTAT ACGCACGGGTATATACCTAGT 71709 90395 18686 -
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTGTATCTATATC CGCAACGCACGTGCACTCACCTAGT 79297 180459 259756 +
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTCTACTACTC CAACGCACGGGCACACACCTAGT 79493 82048 2555 -
gi|13606087|gb|AF090447.2|AF090447 AF090447 ATCTCTACTACTCCT TGCAACGCACGGGTACTGACCTAGT 82089 4408 86497 +
gi|58082239|gb|AC155376.2|AC155376 AC155376 ATCTGTATCTATA GCAACGCACGGGCACTCACCTAGT 83983 29828 113811 +
gi|90568150|gb|AC183938.1|AC183938 AC183938 ATCTATACTACTTAT TGCAACGCACGGGTACTGACCTAGT 85133 50362 135495 +
gi|90265901|gb|AC183908.1|AC183908 AC183908 ATCTCTACTACTC CACGGGCACTGACCTAGT 87692 52050 139742 +
gi|58082269|gb|AC155407.2|AC155407 AC155407 ATCTCTACTACTC GCAACGCACGGGCACCTACCTAGT 91875 7000 98875 +
gi|58082374|gb|AC155514.2|AC155514 AC155514 ATCTATACTACCTAT GCAACGCACGGGCACATACCTAGT 95346 113293 17947 -
gi|91982801|gb|AC185257.1|AC185257 AC185257 ATCTCTACTACTTAT GCAACGCACGGGCACTCAGCTAGT 95441 107994 12553 -
gi|91982801|gb|AC185257.1|AC185257 AC185257 ATCTCTACTACTTAT GCAACGCATGGGCACTCACCTAGT 96142 107994 11852 -
gi|91065005|gb|AC184781.1|AC184781 AC184781 ATCTATACTACTTAT CAACGCACGGGCACACACCTAGT 96240 98795 2555 -
gi|58082423|gb|AC155564.2|AC155564 AC155564 ATCTATACTACTC GCAACGCACGTGCATATACCTAGT 97660 190325 92665 -
gi|85861336|gb|AC177826.1|AC177826 AC177826 ATCTCTACTACTCCT GGCACTCACCTAGT 98509 65632 164141 +
gi|89257775|gb|AC177893.2|AC177893 AC177893 ATCTATACTACCTAT GCAACGCACGGGCACATACCTAGT 100259 178518 78259 -
gi|93352753|gb|AC185639.1|AC185639 AC185639 ATCTCTACTACTC GCAACGCACGGACACATACCTAGT 100407 129567 29160 -
gi|58082437|gb|AC155578.2|AC155578 AC155578 ATCTATACTACTT GCAACGCACGGGCATCTACCTAGT 100842 61181 162023 +
gi|90963037|gb|AC184165.1|AC184165 AC184165 ATCTCTACTACTTAT GCAACGCACGGGCACTCACCTAGT 101578 32855 134433 +
gi|90265901|gb|AC183908.1|AC183908 AC183908 ATCTCTACTACTTAT CACGGGCACTGACCTAGT 102421 37321 139742 +
gi|92899742|gb|AC185426.1|AC185426 AC185426 ATCTCTACTACTC AGCAACGCACGGGCATTTACCTAGT 103489 9650 113139 +
gi|58082233|gb|AC155370.2|AC155370 AC155370 ATCTCTACTACTT TGCAACGCACGGGCACTGACCTAGT 103559 227706 124147 -
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTCTACTACTCCT AACGCACGGGTACTCACCTAGT 104030 193964 89934 -
gi|93004172|gb|AC185501.1|AC185501 AC185501 ATCTGTATCTATA GCAACGCACGGGCAGTCACCTAGT 105412 118624 13212 -
gi|57790136|gb|AC149815.2|AC149815 AC149815 ATCTCTACTACTC TGCAACGCACGGGCACTTACCTAGT 106804 16368 123172 +
gi|90992700|gb|AC184703.1|AC184703 AC184703 ATCTCTACTACTTAT GCAACGCACGGGCACTTTCCTAGT 108254 94816 203070 +
gi|93204902|gb|AC185519.1|AC185519 AC185519 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 109338 12808 122146 +
gi|88024660|gb|AC182625.1|AC182625 AC182625 ATCTCTACTACTC GCAACGCACGGGTACTCACCTAGT 110183 4447 114630 +
gi|90992700|gb|AC184703.1|AC184703 AC184703 ATCTCTACTACTTAT GCAACGCACGGGCACATACCTAGT 118536 94816 213352 +
gi|93277168|gb|AC185526.1|AC185526 AC185526 ATCTCTACTACTTAT TGCAACGCACGGGCACTGACCTAGT 119129 156378 37249 -
gi|85861424|gb|AC177914.1|AC177914 AC177914 ATCTCTACTACTC GCAACGCACGGGCACTCACCTAGT 119188 213254 94066 -
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTCTACTACTCCT GCAATGCACGGGTACTCACCTAGT 120844 193964 73120 -
gi|90265901|gb|AC183908.1|AC183908 AC183908 ATCTATACTACTTAT CACGGGCACTGACCTAGT 124843 14899 139742 +
gi|85861441|gb|AC177931.1|AC177931 AC177931 ATCTCTACTACTTAT GCAACGCACGGGCACTATACTAGT 127646 13174 140820 +
gi|62123048|gb|AC150740.3|AC150740 AC150740 ATCTGTATCTATAT TGCAACGCACGGGTACTGACCTAGT 137315 27700 165015 +
gi|58082458|gb|AC155599.2|AC155599 AC155599 ATCTCTACTACTTAT TGCAACGCACGGGTACTGACCTAGT 146659 167834 21175 -
gi|58082250|gb|AC155388.2|AC155388 AC155388 ATCTCTACTACTTAT GCAACGCACGGGCACTCAGCTAGT 154309 8339 162648 +
gi|2|gb|Maize_contig_rf1-right|887619 Maize_contig_rf1-right ATCCCTACTACTAAT GCAACGCACGGGCACTAATCTAGT 165694 352672 518366 +
gi|48762539|gb|AC145726.6|AC145726 AC145726 ATCTCTACTACTCCT GCAACGCACGGGCACTCACCTAGT 168778 193964 25186 -
gi|90992700|gb|AC184703.1|AC184703 AC184703 ATCTCTACTACTTAT GCAACGCACGGGCACTTTCCTAGT 198762 4308 203070 +
gi|55741039|gb|AY664413.1|AY664413 AY664413 ATCTCTACTACTCCT GCACGGGCACATACCTAGT 205817 210886 5069 -
gi|90992700|gb|AC184703.1|AC184703 AC184703 ATCTCTACTACTTAT GCAACGCACGGGCACATACCTAGT 209044 4308 213352 +
gi|58082333|gb|AC155472.2|AC155472 AC155472 ATCTAAAGTATTAAA AGCAAAGCACGGGCATACACCTAGT 221929 4622 226551 +
gi|2|gb|Maize_contig_rf1-right|887619 Maize_contig_rf1-right ATCCCTACTACTAAT AACGCACGGGTATTTACCTAGT 264953 352672 617625 +